View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985A_low_63 (Length: 377)
Name: NF9985A_low_63
Description: NF9985A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985A_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 362
Target Start/End: Complemental strand, 32279021 - 32278660
Alignment:
| Q |
7 |
gttttattatgggtttcatcgacatatcttatatgaaggctaaagctatgtatctcaatctgaatactgggtttttagcagaagactagtttttgtagcg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32279021 |
gttttattatgggtttcatcgacatatcttatatgaaggctaaagctatgtatctcaatctgaatactgggtttttagcagaagactagtttttgtagcg |
32278922 |
T |
 |
| Q |
107 |
caagtttacataatgttatgc------gttgaataaggatttgttttctttgttggatacatttttgtatgaggatacatactggaattttagaggcata |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| |||| || ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32278921 |
caagtttacataatgttatgcttttttgttgaatcaggatttgttttttttgctgtatacatttttgtatgagtatacatactggaattttagaggcata |
32278822 |
T |
 |
| Q |
201 |
tatgccgttttgcttccaaatttacgtacatcagacacgtccttattttgacatgagtatgaccaaagctattctattcttgttgcctatactatcatag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32278821 |
tatgccgttttgcttccaaatttacgtacgtcagacatgtccttattttgacatgagtatgaccaaagctattctattcttgttgcctatactatcatag |
32278722 |
T |
 |
| Q |
301 |
ttattgacttgtttgtttatacaaatagaatgcagagttctcttgcataattttgagtgaat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32278721 |
ttattgacttgtttgtttatacaaatagaatgcagagttctcttgcataattgtgagtgaat |
32278660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University