View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9985_high_28 (Length: 222)

Name: NF9985_high_28
Description: NF9985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9985_high_28
NF9985_high_28
[»] chr4 (1 HSPs)
chr4 (19-206)||(11024219-11024406)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 11024219 - 11024406
Alignment:
19 ggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtgcatcgcattggcgtggaagttggcgccgcagagtggagcatg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
11024219 ggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtgcatcgcattggcgtggaagttggcgccgcggagtggagcatg 11024318  T
119 tcgccttatgatgctaagaagacagtggtgagagctgaaaggatagagaaagctgtgaagaaattgatggatagtaatggtgaaggtg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024319 tcgccttatgatgctaagaagacagtggtgagagctgaaaggatagagaaagctgtgaagaaattgatggatagtaatggtgaaggtg 11024406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University