View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985_low_15 (Length: 309)
Name: NF9985_low_15
Description: NF9985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 34 - 221
Target Start/End: Complemental strand, 5064516 - 5064329
Alignment:
| Q |
34 |
ggttgagggatatatacgttttgctaagctagggaaacgtacgttgtaattagtttagctaatactgtagaaaattatagtaactgctaattatagttac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5064516 |
ggttgagggatatatacgttttgctaagctagggaaacgtacgttgtaattagtttagctaatactgtagaaaattatagtaactgctaattatagttac |
5064417 |
T |
 |
| Q |
134 |
ttttaattttgggttttcttcctattgtatgttttataaatcattatagaatacctcattctaagaatctaaagacattagtactagt |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5064416 |
ttttaattttgtgttttcttcctattgtatgttttataaatcattatagaatacctcattctaagaatctaaagacattagtactagt |
5064329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University