View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985_low_24 (Length: 239)
Name: NF9985_low_24
Description: NF9985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 89
Target Start/End: Complemental strand, 9913892 - 9913808
Alignment:
| Q |
5 |
gttgactcaactttttcttatatttaaggccgaagaaaatatattttattcattatgtgactttcttcacttttttgggttcctc |
89 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
9913892 |
gttgactcaacttttgcttatatttgagattgaagaaaatatattttatttactatgtgactctcttcacttttttgggttcctc |
9913808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 9913717 - 9913673
Alignment:
| Q |
180 |
gtgagacactaaattagagaaattgagtcatgtatgtatacatat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9913717 |
gtgagacactaaattagagaaattgagtgatgtatgtatacatat |
9913673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University