View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9985_low_8 (Length: 407)
Name: NF9985_low_8
Description: NF9985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9985_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 95 - 292
Target Start/End: Complemental strand, 28137335 - 28137133
Alignment:
| Q |
95 |
gtataacgcatgatgcatccaacggattatattaagcgaatgtaactgtgggtttcccgcgtgaaagacagagaatcagtttccgttacactagcgccat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28137335 |
gtataacgcatgatgcatccaacggattatactaagcgaaagtaactgtgggtttcccgcgtgaaagacagagaatcagtttccgttacactagcgccat |
28137236 |
T |
|
| Q |
195 |
taccagtg-----gcattccttcaaatcaatcaccgagcacacgcacctcacggaacggatcttcattctcattcttaatcacaaaccgaaccttttgga |
289 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28137235 |
taccagtggcatggcattccttcaaatcaatcaccgagcacacgcacctcacggaacggatcttcattctcattctcaatcacaaaccgaaccttttgga |
28137136 |
T |
|
| Q |
290 |
tcc |
292 |
Q |
| |
|
||| |
|
|
| T |
28137135 |
tcc |
28137133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 352 - 407
Target Start/End: Complemental strand, 28137073 - 28137018
Alignment:
| Q |
352 |
atccacaaccaagttacatgaatacaaattcaaatccaaatcgtgttcgtcttttc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28137073 |
atccacaaccaagttacatgaatacaaattcaaatccaaatcgtgttcgtcttttc |
28137018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University