View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9986_high_11 (Length: 250)
Name: NF9986_high_11
Description: NF9986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9986_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 37168193 - 37168311
Alignment:
| Q |
13 |
gttcgatgtcaaaatgactatcattatacctttttgaaaagggaattgacctacaagatgaactcatcgctttctcatgaaatatgatatttttaagcca |
112 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
37168193 |
gttcgatgtcaaaatgactattattttacctttttgaaaagggaattgacctacaagatgaactcatcgctttctcatcaaatatgatattttaaagcca |
37168292 |
T |
|
| Q |
113 |
ttcgagttcgtccgaagca |
131 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37168293 |
ttcgagttcgtccgaagca |
37168311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 37168385 - 37168430
Alignment:
| Q |
205 |
agggtttcctttagtatttaaatgcttagttgtagccagagaaaca |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37168385 |
agggtttcctttagtatttaaacgcttagttgtagccagataaaca |
37168430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 6911438 - 6911483
Alignment:
| Q |
18 |
atgtcaaaatgactatcattatacctttttgaaaagggaattgacc |
63 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| || |||||||||||| |
|
|
| T |
6911438 |
atgtcagaatgactattattatacctttttaaagagggaattgacc |
6911483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University