View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9986_high_4 (Length: 373)
Name: NF9986_high_4
Description: NF9986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9986_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 357
Target Start/End: Original strand, 7226895 - 7227230
Alignment:
| Q |
15 |
ctgtgtctgataatgcaattgttgtgtcatattgtacaagtttatgcttgggtgctgtgtgttggtgaatctcctcagatgtaccattttactatatatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7226895 |
ctgtgtctgataatgcaattgttgtgtcatattgtacaaatttata---------tatgtgttggtgaatctcctcagatgtaccattttactatatatt |
7226985 |
T |
|
| Q |
115 |
ttggtgtgctttgatcatgggccat--ttttcagaggactacttgcattttggtgctggcttgtgttggcgagtagctcaacttattatagcttagagat |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||| | |
|
|
| T |
7226986 |
ttggtgtgctttgatcatgggccatatttttcagaggactacttgcattttggtgctggcttgcgttggcgagtagctcaacttgttatagctaagagtt |
7227085 |
T |
|
| Q |
213 |
aaaaagttgcaagagtaaaacaattagagatcaaactccggcaaaggggaaaaagtaatattgtacttgcatttgcttatgcaaattaaaatgaacatgc |
312 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7227086 |
aaaaagttgcaagagtaaaacaatgagagatcaaactccggcaaaggggaaaaactaatattgtacttgcatttgcttatgcaaaataaaatgaacatgc |
7227185 |
T |
|
| Q |
313 |
ttgatgcttcaacaatatgtattaatctttggatgtctcataagt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7227186 |
ttgatgcttcaacaatatgtattaatctttggatgtctcataagt |
7227230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University