View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9986_high_8 (Length: 285)
Name: NF9986_high_8
Description: NF9986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9986_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 269
Target Start/End: Original strand, 39395634 - 39395888
Alignment:
| Q |
15 |
cacagaggggggaataatgaagaggttgttaataaagaaattattgtagaagatgatacactaaagggttcaatatttgatgaagtggaggacgattcac |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39395634 |
cacaaaggggggaataatgaagaggttgttaataaagaaattattgtagaagatgatacactaaagggttcaatatttgatgaagtggaggacgattcac |
39395733 |
T |
 |
| Q |
115 |
ctgattcagaaacacatgttgaaatgggaattcatgatgactttgatcatttagatgaatcacattttgatgattctgaggctgatagaaacaacagaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39395734 |
ctgattcagaaacacatgttgaaatgggaattcatgaagattttgatcatttagatgaatcacattttgatgattctgaggctgatagaaacaacagaaa |
39395833 |
T |
 |
| Q |
215 |
aagtaaagcattgctgagaagatttggtgatcttataaggagaaaaagtactact |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39395834 |
aagtaaagcattgctgagaagatttggtgatcttataaggagaaaaagtactact |
39395888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University