View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9986_low_9 (Length: 343)
Name: NF9986_low_9
Description: NF9986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9986_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 10320617 - 10320783
Alignment:
| Q |
1 |
tgatcatagctaatcggtcttgactcttgatgttggaagaagtaagaatttccgttgaaaaagtttagggcatcttttctgaagtagc----gcatgcat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10320617 |
tgatcatagctaatcggtcttgactcttgatgatggaagaagtaagaatttccgttgaaaaagtttagggcatcttttctgaagtagcgcatgcatgcat |
10320716 |
T |
|
| Q |
97 |
gcatgcatgcaatgcacttgtttagacattcaagaaagaaaggaagcattcattattgataaacaga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10320717 |
gcatgcatgcaatgcacttgtttagacattcaagaaagaaaggaagcattcattattgataaacaga |
10320783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 201 - 331
Target Start/End: Original strand, 10320822 - 10320952
Alignment:
| Q |
201 |
tcttcaatattcctcttttggaactctcacgaatattgaaggtgcgtgtcactctctgcatgctatatattttccacatgcctattgtttgtagttagtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10320822 |
tcttcaatattcctcttttggaactctcacgaatattgaaggtgcgtgtcactctctgcatgctatcaattttccacatgcctattgtttgtagttagtt |
10320921 |
T |
|
| Q |
301 |
gtgaatgtggactccatctttcttctgacac |
331 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
10320922 |
gtgaatgtggactccatcttccttctgacac |
10320952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University