View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9987_high_5 (Length: 228)
Name: NF9987_high_5
Description: NF9987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9987_high_5 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 39396585 - 39396374
Alignment:
| Q |
17 |
gtttgtacctatttgttttgtgtcaaggatcaatatcaaatgaaacatgttcaataactttactgaatcaagatttgtccaaaatacggcactcgcagca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| || |
|
|
| T |
39396585 |
gtttgtacctatttgttttgtgtcaaggatcaatatcaaatgaaacatgttcaataacttcactgaatcaagatgtgtccaaaatacggcacttgcaaca |
39396486 |
T |
 |
| Q |
117 |
tccaagccctccctctttcttgtcaaatacatatactttgcacattctattaagttcaatagctgctgcattgttgtgtaagaaactctcaaagaagatt |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39396485 |
tccaagtcctccctctttcttgtcaaatacatatactttgcacattctattaagttcaatagctgctgcatttttgtgtaagaaactctcaaagaagatt |
39396386 |
T |
 |
| Q |
217 |
gataagtactcc |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39396385 |
gataagtactcc |
39396374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 221
Target Start/End: Complemental strand, 43597970 - 43597914
Alignment:
| Q |
162 |
tctattaagttcaatagctgctgcattgttgtgtaagaaactctcaaagaagattgataa |
221 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
43597970 |
tctattaagttcaatagctgc---atttttgtgtaagaacctctcaaagaagatcgataa |
43597914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University