View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9987_high_6 (Length: 226)
Name: NF9987_high_6
Description: NF9987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9987_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 32581544 - 32581350
Alignment:
| Q |
15 |
cagagaagcgtaaaaggtactcggcgaacataattcaaaatttaagattaggataattattcgttaaagaaacggattagcannnnnnnnaccgaacaaa |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32581544 |
cagaaaagcgtaaaaggtactcggcgaacataattcaaaatttaagattaggataattattcgttaaagaaacggattagcattttttttaccgaacaaa |
32581445 |
T |
|
| Q |
115 |
tgggttagtgtctttactattagtaactgcttttggtgattcattaacacgattcgtttacgcgtccacctatagattttttcatacgcgatttt |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581444 |
tgggttagtgtttttactattagtaactgcttttggtgattcattaacacgattcgtttacgcgtccacctatagattttttcatacgcgatttt |
32581350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University