View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9988_high_10 (Length: 240)
Name: NF9988_high_10
Description: NF9988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9988_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 11621435 - 11621320
Alignment:
| Q |
1 |
gttcgagttcgtctttgatgtattgaacatcttcacggacgcctctttgtagatttacctcttcttgaagtaaccaagttagcttctccaacaaaaatga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11621435 |
gttcgagttcgtcgttgatgtattgaacatcttcacggacgcctctttgtagatttacctcttcttgaagtaaccaagttagcttctccaacaaaaatga |
11621336 |
T |
 |
| Q |
101 |
tactgaactctctgcc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11621335 |
tactgaactctctgcc |
11621320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 11639926 - 11639811
Alignment:
| Q |
1 |
gttcgagttcgtctttgatgtattgaacatcttcacggacgcctctttgtagatttacctcttcttgaagtaaccaagttagcttctccaacaaaaatga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
11639926 |
gttcaagttcgtctttgatgtattgaacatcttcacggactcctctttgtagatttacttcctcttgaagtaaccatgttagcttgtccaataaaaatga |
11639827 |
T |
 |
| Q |
101 |
tactgaactctctgcc |
116 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
11639826 |
tactgaactgtctgcc |
11639811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 11606142 - 11606253
Alignment:
| Q |
5 |
gagttcgtctttgatgtattgaacatcttcacggacgcctctttgtagatttacctcttcttgaagtaaccaagttagcttctccaacaaaaatgatact |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||| |||| |||||||||||||||||| | || || ||||| |||||||||||| |
|
|
| T |
11606142 |
gagttcgtctttgatgtattgaacatcttcacggacccctttttgtagaattacttcttcttgaagtaaccaactcagtttgtccaataaaaatgatact |
11606241 |
T |
 |
| Q |
105 |
gaactctctgcc |
116 |
Q |
| |
|
||||| |||||| |
|
|
| T |
11606242 |
gaactatctgcc |
11606253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Complemental strand, 11621252 - 11621210
Alignment:
| Q |
183 |
gctctctagatgagaaaagtttcaagaactttatgatgagatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11621252 |
gctctctagatgagaaaagtttcaagaacttgatgatgagatt |
11621210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 11639339 - 11639300
Alignment:
| Q |
183 |
gctctctagatgagaaaagtttcaagaactttatgatgaga |
223 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
11639339 |
gctctctagatgagaaa-gtttcaagaacttgatgatgaga |
11639300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University