View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9990_low_5 (Length: 251)
Name: NF9990_low_5
Description: NF9990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9990_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 66 - 241
Target Start/End: Complemental strand, 29770929 - 29770754
Alignment:
| Q |
66 |
tagctcataagtttaatgaacttgctcgcaagttagttttgataaaactatggtcacaaagctagatcagcatatcataaccttgttgaagttgaacatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29770929 |
tagctcataagtttaatgaacttgctcgcaagttagttt-gataaaactagggtcacaaagctagatcagcatatcataaccttgttgaagttgaacatg |
29770831 |
T |
|
| Q |
166 |
ttgctaacttactatatt-ttttggatatggcatttggacttataactcactatttttgtctaacgtgttccctttg |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29770830 |
ttgctaacttactatatttttttggatatggcatttggacgtataactcactatttttgtctaacgtgttccctttg |
29770754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University