View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9991_low_16 (Length: 337)
Name: NF9991_low_16
Description: NF9991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9991_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 168
Target Start/End: Complemental strand, 25838133 - 25837983
Alignment:
| Q |
18 |
gaggtcagctgggcggggcatctaaatcaattatactcttgtgattctctttattctttattgctttcgtaaatcagattagcataatattaatatccac |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25838133 |
gaggtcagctgggcagggcatctaaatcaattatactcttgtgattctctttattctttattgcttttgtaaatcagattagcataatattaatatccac |
25838034 |
T |
|
| Q |
118 |
ccgttaatagaataaaactctatcattttgaattgataaaaacattactta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25838033 |
ccgttaatagaataaaactctatcattttgaattgataaaaatattactta |
25837983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 165 - 331
Target Start/End: Complemental strand, 25837634 - 25837469
Alignment:
| Q |
165 |
cttaatatatgcagaaattgaatttgaaccttcaatttctcaattattcatcttnnnnnnngtgaattgctgctgtttaataagttgtttattgtagatt |
264 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25837634 |
cttaatacaagcagaaattgaatttgaaccttcaatttctcaattatttatcttaaaaaa-gtgaattgctactgtttaataagttgtttattgtagatt |
25837536 |
T |
|
| Q |
265 |
attactagaaaaatataatatgacaattgatgccactttgaaaaagttgaaatttctgatgtccatc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25837535 |
attactagaaaaatataatatgacaattgatgccactttgaaaaagttgaaatttctgatctccatc |
25837469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University