View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9991_low_18 (Length: 280)
Name: NF9991_low_18
Description: NF9991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9991_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 30 - 270
Target Start/End: Original strand, 2886320 - 2886560
Alignment:
| Q |
30 |
aacaataaatgaagaatcagaagacagcacaacaaatggcactacccaagaagttgaattaccgcgtataggtgatctatctttttcataccactcgtga |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886320 |
aacaataaatgaagaatcagaagacagcacaacaaatggcactacccaagaagttgaattaccacgtataggtgatctatctttttcataccactcgtga |
2886419 |
T |
|
| Q |
130 |
aaactcaatataaacatgctacttttatgtgtttgaactagttcattagtgatttataatgcattttgattttatttaatattatttgggtgtagtcttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886420 |
aaactcaatataaacatgctacttttatgtgtttgaactagttcattagtgatttataatgcattttgattttatttaatattatttgggtgtagtcttg |
2886519 |
T |
|
| Q |
230 |
attattgttagggctgggatctcagttttctataatgatgt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886520 |
attattgttagggctgggatctcagttttctataatgatgt |
2886560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 33 - 148
Target Start/End: Complemental strand, 2898098 - 2897983
Alignment:
| Q |
33 |
aataaatgaagaatcagaagacagcacaacaaatggcactacccaagaagttgaattaccgcgtataggtgatctatctttttcataccactcgtgaaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||| || ||||||||||||||| || |||||| |
|
|
| T |
2898098 |
aataaatgaagaatcagaagacagcataacaaatggcactctccaagaagttgaattaccgcgcataggttatgaatctttttcataccattcatgaaaa |
2897999 |
T |
|
| Q |
133 |
ctcaatataaacatgc |
148 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2897998 |
ctcaatataaacatgc |
2897983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University