View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9992_low_2 (Length: 285)

Name: NF9992_low_2
Description: NF9992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9992_low_2
NF9992_low_2
[»] chr2 (1 HSPs)
chr2 (7-51)||(31412855-31412899)


Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 31412899 - 31412855
Alignment:
7 agtttaaagcctataacagagaaatgtttgcatagtttgaagcct 51  Q
    ||||| |||||||||||||||||||||||||||||||||||||||    
31412899 agtttgaagcctataacagagaaatgtttgcatagtttgaagcct 31412855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University