View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9992_low_3 (Length: 249)
Name: NF9992_low_3
Description: NF9992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9992_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 16659407 - 16659178
Alignment:
| Q |
12 |
caagactacacggcagtgaagtaatgcagcagtcagctagagggaaaaacagaaacaacagagttgaatcagattgatgacagcaaaaggccgaacttcc |
111 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |||||| |||||||||||| |||||| ||||| |||||||||||||||||| | ||||||| |
|
|
| T |
16659407 |
caagactacactgcagtggagtaatgcagcagtcagc-agagggcaaaacagaaacagcagagtcaaatcaaattgatgacagcaaaaggtccaacttcc |
16659309 |
T |
|
| Q |
112 |
actgtaacagacataaatcaatgcatc---taccacaccaccttaccatatacgtattaattaatgtcgtgtaatttttcagaatttaatatttttatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16659308 |
actgtaacagacataaatcaatgcatcatctaccacaccaccttaccatatatgtactaattaatgtcgtgtaatttttcagaatttaatatgtttatgt |
16659209 |
T |
|
| Q |
209 |
aacaat---ttatcaacatacccttttcacc |
236 |
Q |
| |
|
|||||| | |||||||||||||||||||| |
|
|
| T |
16659208 |
aacaatatatcatcaacatacccttttcacc |
16659178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University