View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_high_25 (Length: 239)
Name: NF9993_high_25
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31432575 - 31432798
Alignment:
| Q |
1 |
cttttgtgttgaaaaagatgaccgagatagttattttgataagcaaattatccagtgggagtacgtatttcattggaggtatcattagaatgatgtagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31432575 |
cttttgtgttgaaaaagatgaccgagatagttaatttgataagcaaattatccagtgggagtacgtatttcattggaggtatcattagaatgatgtagcc |
31432674 |
T |
|
| Q |
101 |
tatgtttagattggtggtgaaatacatttttccacgtctcaatgtagacaccttgtgaaaattaggaagctccaatttgtatcagtagctaaacaaaaat |
200 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31432675 |
tatgtttagattggtggcgacatacatttttccgcgcctcaatgtagacaccttgtgaaaattaggaagctccaatttgtatcagtagctaaacaaaaat |
31432774 |
T |
|
| Q |
201 |
gatgcagcattccgttgtggttat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31432775 |
gatgcagcattccgttgtggttat |
31432798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University