View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_12 (Length: 290)
Name: NF9993_low_12
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 88 - 269
Target Start/End: Complemental strand, 4953746 - 4953569
Alignment:
| Q |
88 |
attgtgaccataaagatgagaagattattgtgtatgattataattccaatggttctctctataatcatctttgttgtgtacataatagtggcatgaaaat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953746 |
attgtgaccataaagatgagaagattatt----atgattataattccaatggttctctctataatcatctttgttgtgtacataatagtggcatgaaaat |
4953651 |
T |
 |
| Q |
188 |
tgaacctcttacatggaaacaaaggctaaaaatttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaa |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953650 |
tgaacctcttacatggaaacaaaggctaaaaatttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaa |
4953569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University