View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_17 (Length: 262)
Name: NF9993_low_17
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 114 - 246
Target Start/End: Complemental strand, 28529988 - 28529855
Alignment:
| Q |
114 |
acatactgcgttgcatggtattggttatcttggttaagggtttattctaaagattccaaataggttcttaatattcattcccacgcc-nnnnnnntgtga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28529988 |
acatactgcgttgcatggtattggttatcttggttaagggtttattctaaagattccaaataggttcttaatattcattcccacgccaaaaaaaatgtga |
28529889 |
T |
 |
| Q |
213 |
aagaaattaagaaaagtttttcaaccttaatatc |
246 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
28529888 |
aaggaattaagaaaagtttttcaaccttaatatc |
28529855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 28530079 - 28530046
Alignment:
| Q |
25 |
ttgaagacaactacctcgtaaccattgtatgtgg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28530079 |
ttgaagacaactacctcgtaaccattgtatgtgg |
28530046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University