View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_20 (Length: 254)
Name: NF9993_low_20
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45860014 - 45859774
Alignment:
| Q |
1 |
tagttgcagaaagcaagttcagatgatggtacacttcagctttatgagcagctcagtttttcatatccatccctattgccacctcttatacatgaacgag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45860014 |
tagttgcagaaagcaagttcaaatgatggtacacttcagctttatgagcagctcagtttttcatatccatccctattgccacctcttatacatgaacgag |
45859915 |
T |
|
| Q |
101 |
atactgtaagtttttcttcctctcactctaaaattgcatcgcagtatccttttgcatgttacaagtcctacaaggctacaacttcaagtaaaacaatagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45859914 |
atactgtaagtttttcttcctctcactctaaaattgcatcgcagtatccttttgcatgttacaagtcctacaaggctacaacttcaagtaaaacaatagt |
45859815 |
T |
|
| Q |
201 |
annnnnnnnnncctgttctgcagtatcttgcatggtctctg |
241 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
45859814 |
atttttttcttcctgttctgcagtatcttgcatggtctctg |
45859774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 27003768 - 27003603
Alignment:
| Q |
8 |
agaaagcaagttcagatgatggtacacttcagctttatgagcagctcagtttttcatatccatccctattgccacctcttatacatgaacgagatactgt |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27003768 |
agaaagcaagttcagatgatgctacacttcagccttatgagcagctcagtttttcatatccatccttattgccacctcttatacatgaacgagatactgt |
27003669 |
T |
|
| Q |
108 |
aagtttttcttcctctcactctaaaattgcatcgcagtatccttttgcatgttacaagtcctacaa |
173 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27003668 |
aagtttttcttcctctcactcaaaaattccatcgcagtatccttttgcatgtgacaagtcctacaa |
27003603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 27003576 - 27003548
Alignment:
| Q |
213 |
ctgttctgcagtatcttgcatggtctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27003576 |
ctgttctgcagtatcttgcatggtctctg |
27003548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 173
Target Start/End: Original strand, 35537469 - 35537634
Alignment:
| Q |
8 |
agaaagcaagttcagatgatggtacacttcagctttatgagcagctcagtttttcatatccatccctattgccacctcttatacatgaacgagatactgt |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35537469 |
agaaagcaagttcagatgatgctacacttcagccttatgagcagctcagtttttcatatccatccttattgccacctcttatacatgaacgagatactgt |
35537568 |
T |
|
| Q |
108 |
aagtttttcttcctctcactctaaaattgcatcgcagtatccttttgcatgttacaagtcctacaa |
173 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35537569 |
aagtttttcttcctctcactcaaaaattccatcgcagtatccttttgcatgtgacaagtcctacaa |
35537634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Original strand, 35537661 - 35537689
Alignment:
| Q |
213 |
ctgttctgcagtatcttgcatggtctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35537661 |
ctgttctgcagtatcttgcatggtctctg |
35537689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University