View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_21 (Length: 253)
Name: NF9993_low_21
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 43854466 - 43854227
Alignment:
| Q |
11 |
agcataggcaaatgcaacatcacctaaagcactgaagaaattgaaaacagttcctgttggagttgtggctttgtagccatatgccacatctggttgaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854466 |
agcataggcaaatgcaacatcacctaaagcactgaagaaattgaaaacagttcctgttggagttgtggctttgtagccatatgccacatctggttgaact |
43854367 |
T |
 |
| Q |
111 |
ccctttttcaatgaagccacccatgcaattgttgagtaactacataggacaaatttccaccataaatttagttaaaaattaaattaagaagataaaatat |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43854366 |
cccttttttaatgaagccacccatgcaattgttgagtaactacataggacaaattt---ccataaatttatttaaaaattaaattaagaagataaaatat |
43854270 |
T |
 |
| Q |
211 |
gatattaccattgtacttttattttatatattaatttctggac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854269 |
gatattaccattgtacttttattttatatattaatttctggac |
43854227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University