View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_36 (Length: 227)
Name: NF9993_low_36
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_36 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 506202 - 506007
Alignment:
| Q |
12 |
cgagtgagaagaatgtgagaattgtgtttctgggaaaaccaatttgtgtttgacacatcctgtgagattgactggtctaatgccagataacacttcaagg |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506202 |
cgagtgtgaagaatgtgagaattgtgtttctgggaaaaccaatttgtgtttgacacatcctgtgagattgactggtctaatgccagataacacttcaagg |
506103 |
T |
 |
| Q |
112 |
ttgtctgtccgaggccaaacattataccatgttttgagttgtgcttcatggtcggaatatgtggtggttgatatcaattaccttgttaaagttgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
506102 |
ttgtctgtccgaggccaaacattataccatgttttgagttgtgcttcatggtcggaatatgtggtggttgatatcaattaccttcttagagttgat |
506007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 20052088 - 20051913
Alignment:
| Q |
20 |
aagaatgtgagaattgtgtttctgggaaaaccaatttgtgtttgacacatcctgtgagattgactggtctaatgccagataacacttcaaggttgtctgt |
119 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||| | ||| | ||| | ||||||||||| || ||||||||||| |||||||||||||| ||||| || |
|
|
| T |
20052088 |
aagaatgtgtgaattgtgtttcaagaaaaaccaatctttgtcttacataccctgtgagattcaccggtctaatgcccgataacacttcaagattgtccgt |
20051989 |
T |
 |
| Q |
120 |
ccgaggccaaacattataccatgttttgagttgtgcttcatggtcggaatatgtggtggttgatatcaattacctt |
195 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||| |||||||||| ||||| || |||||| |||| |||||| |
|
|
| T |
20051988 |
tcgaggccaaagactatatcatgttttgagttgtgctacatggtcggagtatgtcgttgttgatgtcaactacctt |
20051913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University