View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9993_low_38 (Length: 207)
Name: NF9993_low_38
Description: NF9993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9993_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 29663079 - 29662880
Alignment:
| Q |
1 |
aagccatgaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663079 |
aagccatgaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatgg |
29662980 |
T |
|
| Q |
101 |
agatttggttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccctatgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29662979 |
agatttggttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccccatgctt |
29662880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 201
Target Start/End: Original strand, 33201384 - 33201578
Alignment:
| Q |
7 |
tgaaactccctctctgcctgcatccacttcatgccaatcaccacaactcgaaccttgacatccttcgcaatttcgggcattttttgattcatggagattt |
106 |
Q |
| |
|
||||| ||||||||||||| ||||||||| | || |||||||||||||||||||||||||| || ||||| | ||||||||| ||||||||| | | |
|
|
| T |
33201384 |
tgaaattccctctctgcctccatccactttgtaccgatcaccacaactcgaaccttgacatctttggcaatcttgggcattttctgattcatgaaatatg |
33201483 |
T |
|
| Q |
107 |
ggttttcaccgagaatgtacatgtaacccagcatcttgctacttgagggataagcattcttaattggaccaattctcatgaaaaccctatgcttc |
201 |
Q |
| |
|
||||||||||||||| |||| || || ||||||||||||||||| |||| ||||||| ||||||||||||| ||||||||||| ||||||| |
|
|
| T |
33201484 |
ggttttcaccgagaacatacacatacccaggcatcttgctacttgagagataggcattctctattggaccaattcgcatgaaaaccccatgcttc |
33201578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University