View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9994_low_3 (Length: 263)
Name: NF9994_low_3
Description: NF9994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9994_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 167 - 248
Target Start/End: Complemental strand, 14127982 - 14127901
Alignment:
| Q |
167 |
cccgtcctaagggataaatttactgctcaaacatccttgggttcaaactttgagcgagtcttctaggaatttaagtctcatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14127982 |
cccgtcctaagggataaatttactgctcaaccatccttgggttcaaactttgagcgagtcttgtagaaatttaagtctcatt |
14127901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 14128137 - 14128075
Alignment:
| Q |
13 |
taggcatctcaactctgttgacaccccaggaaactcttatcttcggctacttataatattatt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14128137 |
taggcatctcaactctgttgacaccccaagaaactcttatcttcggctacttataatattatt |
14128075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University