View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9995_high_7 (Length: 387)
Name: NF9995_high_7
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9995_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 136 - 375
Target Start/End: Complemental strand, 31090018 - 31089779
Alignment:
| Q |
136 |
ccctgttgaaattgatgaataaaaatgtctaaatagagagaagtagatggatgggattgcaagagtaaagtttattagtatgactttaaattgtggtcac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31090018 |
ccctgttgaaattgatgaataaaaatgtctaaatagagagaagtagatggatgggattgcaagagtaaagtttattagtatgactttaaattgtggtcac |
31089919 |
T |
|
| Q |
236 |
gagtgtggttacaatgtgagcctttattttgcggtaaacgtgggcactcagaactcagttgcgatgccgttgtagacttcaaaatccataatattgcagc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31089918 |
gagtgtggttacaatgtgagcctttattttgcggcaaacgtgggcagtcagaactcagtttcgatgccgttgtagacttcaaaatccataatattgcagc |
31089819 |
T |
|
| Q |
336 |
cacaattgcgattgtagattgtaatttaaaaccatgtttg |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31089818 |
cacaattgcgattgtagattgtaatttaaaaccatgtttg |
31089779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 2 - 75
Target Start/End: Complemental strand, 31090152 - 31090079
Alignment:
| Q |
2 |
ttggtgttgaattcgctaccagaactatacaggttcatttctttctcttttaagattttctgaaatgtgagcac |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31090152 |
ttggtgttgaattcgctaccagaactatacaggttcatttctttctcttttaagattttctgaaatgtgagcac |
31090079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 326 - 381
Target Start/End: Original strand, 13373758 - 13373813
Alignment:
| Q |
326 |
atattgcagccacaattgcgattgtagattgtaatttaaaaccatgtttgtgatga |
381 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| ||| || |||||| |
|
|
| T |
13373758 |
atattgcagccgcaattgcgattgtagactgcaatttaaaactatggttatgatga |
13373813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University