View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9995_low_16 (Length: 288)
Name: NF9995_low_16
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9995_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 15 - 176
Target Start/End: Complemental strand, 48536770 - 48536609
Alignment:
| Q |
15 |
cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||| || |
|
|
| T |
48536770 |
cagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagagttggcggatctggtgaccgttgtcgctgcagattcgacgaa |
48536671 |
T |
|
| Q |
115 |
agcgccgagcatcgatgttgaggataagcctactctagagtcgacggatctagaatgagtga |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
48536670 |
agcgccgagcatcgatgttgaggataagcctactctagagtcggcggatctagagtgagtga |
48536609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 57 - 138
Target Start/End: Complemental strand, 48533752 - 48533671
Alignment:
| Q |
57 |
acaagtttactgtagagttggcggatccggtgatcgttgtcgctgcagattcgacaaaagcgccgagcatcgatgttgagga |
138 |
Q |
| |
|
||||||||||| |||||||| | ||||||| || || |||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
48533752 |
acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga |
48533671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 271
Target Start/End: Complemental strand, 48536542 - 48536514
Alignment:
| Q |
243 |
atattttagggcttacgtctcttacttca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48536542 |
atattttagggcttacgtctcttacttca |
48536514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University