View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9995_low_19 (Length: 240)
Name: NF9995_low_19
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9995_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 120 - 240
Target Start/End: Complemental strand, 42973985 - 42973865
Alignment:
| Q |
120 |
atatggtcactagtttcatatctaggaaagatcagaccgaaactgtcacctaatttcgtatatgatcacaaataaaaagcgcaagatgtgctaataatac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42973985 |
atatggtcactagtttcatatctaggaaagatcagaccgaaactatcacctaatttcgtatatgttcacaaataaaaagcgcaagatgtgctaataatac |
42973886 |
T |
 |
| Q |
220 |
aatgagataacatagtaaagt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42973885 |
aatgagataacatagtaaagt |
42973865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University