View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9995_low_21 (Length: 235)

Name: NF9995_low_21
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9995_low_21
NF9995_low_21
[»] chr7 (1 HSPs)
chr7 (30-205)||(32115892-32116067)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 30 - 205
Target Start/End: Original strand, 32115892 - 32116067
Alignment:
30 taaggttgagaattgagagccatgagtgaattggatgacccttttgagcaaagtttccggcgaagttgatgggttgcgccggtgagacgacaacgcatga 129  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32115892 taaggttgagaattgagagccatgagtgaattgggtgacccttttgagcaaagtttccggcgaagttgatgggttgcgccggtgagacgacaacgcatga 32115991  T
130 ggggttggtcgggacagaacagaaggtgctactgcagtaataataatgtagtaatgtgactatataatctaaagag 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32115992 ggggttggtcgggacagaacagaaggtgctactgcagtaataataatgtagtaatgtgactatataatctaaagag 32116067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University