View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9995_low_6 (Length: 416)
Name: NF9995_low_6
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9995_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 32115311 - 32115540
Alignment:
| Q |
1 |
tatgttatgtacacaatacctatgtaacatcgacacttctgattgaattgtctggtgtcagactcgtgtgagtttgaca------ccgacaccagacatg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32115311 |
tatgttatgtacacaatacctatgtaacatcgacacttctgattgaattgtctggtgtcagactcgtgtgagtttgacaccgacaccgacaccagacatg |
32115410 |
T |
 |
| Q |
95 |
tatttatattgaattatgtcatttttctcaaattttgatcggtgcacgttagtgtgtcagtgtttgtgcttcatagcacaatactggtataaagtaaaaa |
194 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32115411 |
tatttacattgaattatgtcatttttctcaaattttgatcattgcgcgttagtgtgtcagtgtttgtgcttcatagcacaatactggtataaagtaaaaa |
32115510 |
T |
 |
| Q |
195 |
taatctctcttacagttacacacacaagtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32115511 |
taatctctcttacagttacacacacaagtt |
32115540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 285 - 318
Target Start/End: Original strand, 32115599 - 32115632
Alignment:
| Q |
285 |
tgtgaaaattttcgaactatgacaaaccaataac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32115599 |
tgtgaaaattttcgaactatgacaaaccaataac |
32115632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University