View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9995_low_7 (Length: 403)
Name: NF9995_low_7
Description: NF9995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9995_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 155 - 386
Target Start/End: Original strand, 44311174 - 44311405
Alignment:
| Q |
155 |
tagatgcatctggtttgaggaagttgtcattcaattaacatattgtgatgtaaatctcaatttcaacttctctcctttcttaattttgttcctactattc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
44311174 |
tagatgcatctggtttgaggaagttgtcattcaattaacatattgtgatgtaaatctcaatttcaacttctctcctttcttaattttgtttctattattc |
44311273 |
T |
|
| Q |
255 |
gctcatcagttttagttttagataaaaaatggaaaacgaattcaacaatttttcataaaattgaacccacatgctatgaatttttctaaaaatgttaaat |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311274 |
gctcatcagttttagttttagataaaaaatggaaaacgaattcaacaatttttcataaaattgaacccacatgctatgaatttttctaaaaatgttaaat |
44311373 |
T |
|
| Q |
355 |
ttagaatcatagagattcttgacaacaatgat |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44311374 |
ttagaatcatagagattcttgacaacaatgat |
44311405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 44311015 - 44311066
Alignment:
| Q |
1 |
tattcattgccattaacactaatcttttaaacaacttttgtcaccattgatt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44311015 |
tattcattgccattaacactaatcttttaaacaacttttgtcaccattgatt |
44311066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University