View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9996_low_2 (Length: 270)
Name: NF9996_low_2
Description: NF9996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9996_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 38080488 - 38080246
Alignment:
| Q |
18 |
actcatccattgctctcttgctgtcccccacataaggcacatactgcaaattcaaaactaattaattaataaaaattattcaaagactactacttcaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38080488 |
actcatccattgctctcttgctgtcccccacataaggcacatactgaaaattcaaaactaattaattaataaaaattattcaaagactactacttcaaat |
38080389 |
T |
 |
| Q |
118 |
aaagacagtaaaaataaaagttactaccttaataacaacaacatggtctggatgttcaccaggaccatagaggatggcattgctgttaaccatgtcatca |
217 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38080388 |
aacaccaacaaaaataaaagttactaccttaataacaacaacatggtctggatgttcaccaggaccatagaggatggcattgctgttaaccatgtcatca |
38080289 |
T |
 |
| Q |
218 |
acaacgttactctttgagatttccttagagcggaaggtctgtg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38080288 |
acaacgttactctttgagatttccttagagcggaaggtttgtg |
38080246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 142 - 260
Target Start/End: Complemental strand, 39699904 - 39699786
Alignment:
| Q |
142 |
taccttaataacaacaacatggtctggatgttcaccaggaccatagaggatggcattgctgttaaccatgtcatcaacaacgttactctttgagatttcc |
241 |
Q |
| |
|
||||||||| || |||||||| || |||||||| ||||| |||||||||||||||||||||| ||||| || ||||||||||| ||||| || |||||| |
|
|
| T |
39699904 |
taccttaatgactacaacatgatcaggatgttcgccaggtgcatagaggatggcattgctgttgaccatatcgtcaacaacgttgctcttggaaatttcc |
39699805 |
T |
 |
| Q |
242 |
ttagagcggaaggtctgtg |
260 |
Q |
| |
|
|| ||||||||||| |||| |
|
|
| T |
39699804 |
ttggagcggaaggtttgtg |
39699786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 39700030 - 39699981
Alignment:
| Q |
18 |
actcatccattgctctcttgctgtcccccacataaggcacatactgcaaa |
67 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
39700030 |
actcatccatagctctcttgctgtcaccaacataaggcacatactgcaaa |
39699981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University