View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9997_low_4 (Length: 330)
Name: NF9997_low_4
Description: NF9997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9997_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 17 - 324
Target Start/End: Original strand, 2613103 - 2613410
Alignment:
| Q |
17 |
caaatgcttctttgttgtatctctatctttttgtgcaacttgcatgttgttttgcgaggcgagaaactgagggtgagtctctttttgatgtctaagttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
2613103 |
caaatgcttctttgttgtatctctatctttttgtgcaaattgcatgttgttttgcgaggcgagaaactgagggtgagtctctttttaatgtctaagtata |
2613202 |
T |
 |
| Q |
117 |
ttcccggataatggcatgaaactctggttgggaatttggctacaacatccatttgtaatctttcttgagaaatatttctatgaacgtttgcaactaatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2613203 |
ttcccggataatggcatgaaactctggttgggaatttggctacaacatccatttgtaatctttcttgagaaatatttctatgaacgtttgcaactaatat |
2613302 |
T |
 |
| Q |
217 |
attgctgcctatttgatttactggaggaaatgaataaagacctttctccagctttggtccaaggaatcaaattcctagattgtttagtttcttcgtttcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2613303 |
attgctgcctatttgatttactggaggaaatgaataaagacctttctctagctttggtccaaggaatcaaattcctagattgtttagtttcttcgtttcc |
2613402 |
T |
 |
| Q |
317 |
tttgcttc |
324 |
Q |
| |
|
||| |||| |
|
|
| T |
2613403 |
tttacttc |
2613410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University