View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9998_high_18 (Length: 241)
Name: NF9998_high_18
Description: NF9998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9998_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 36814958 - 36814769
Alignment:
| Q |
19 |
aagtatagctttgtccttgaaatgttatgtttggtttggttttgggaaccgtaactttctcactgaaaaatgacatgatgattgatgagccaagtaatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36814958 |
aagtatagctttgtccttgaaatgttatgtttggtttggttttgggaaccgtaactttctcactgaaaaatgacatgatgattgatgagccaagtaaata |
36814859 |
T |
|
| Q |
119 |
aatattcttaactacaacgaaacaaatcaaatcnnnnnnntgttgaactactaacaaattttttgtgtaccaggacaaaattagatacaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814858 |
aatattcttaactacaacgaaacaaatcaaataaaaaaaatgttgaactactaacaaattttttgtgtaccaggacaaaattagatacaa |
36814769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University