View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9998_low_15 (Length: 388)
Name: NF9998_low_15
Description: NF9998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9998_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 18468758 - 18468390
Alignment:
| Q |
1 |
aggataatgtgatagaaagagagggacatagagaaaatagtgtgttaaatgaatgtatgaaatataaaggtgttcaaatttaagggttgatggtgacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468758 |
aggataatgtgatagaaagagagggacatagagaaaatagtgtgttaaatgaatgtatgaaatataaaggtgttcaaatttaagggttgatggtgacaaa |
18468659 |
T |
 |
| Q |
101 |
ctaaaggaaactcaacccccaaaagttagctcaatgggtgaaaattggggatttgaaccctctctaaaagcttatcgccgccacaaccctccctatttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18468658 |
ctaaaggaaactcaacccccaaaagttagctcaatgggtgaaaattggggatttgaaccctctctaaaagcttctcgccgccacaaccctccctatttcc |
18468559 |
T |
 |
| Q |
201 |
aaactccttcttagatatgtaatggcggccttcctagtggtgcgatgagtggtgctggccatccgcaccacccctcttccagacctgatggtgtttccgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
18468558 |
aaactccttcttagatatgtaatggcggccttcctagtggtgcgatgagtggtgctggccatccgcaccacccctcttccagacctgatggcgttttcgg |
18468459 |
T |
 |
| Q |
301 |
tgctggtggttttgtaggatttagaccagtttgcggtctttgacttggcgatctgcagtttgttcatga |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468458 |
tgctggtggttttgtaggatttagaccagtttgcggtctttgacttggcgatctgcagtttgttcatga |
18468390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 313
Target Start/End: Complemental strand, 22461072 - 22460996
Alignment:
| Q |
237 |
gtggtgcgatgagtggtgctggccatccgcaccacccctcttccagacctgatggtgtttccggtgctggtggtttt |
313 |
Q |
| |
|
||||| ||||||| || ||||||| ||||||||||||||||||| ||||||| | |||| |||| |||||||||| |
|
|
| T |
22461072 |
gtggtccgatgagcggcgctggccctccgcaccacccctcttcctgacctgacagcgtttatggtgttggtggtttt |
22460996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 287
Target Start/End: Complemental strand, 8119779 - 8119729
Alignment:
| Q |
237 |
gtggtgcgatgagtggtgctggccatccgcaccacccctcttccagacctg |
287 |
Q |
| |
|
||||||||||||| || ||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
8119779 |
gtggtgcgatgagcggcgctggccctccccaccacccctcttcctgacctg |
8119729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University