View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9998_low_26 (Length: 255)
Name: NF9998_low_26
Description: NF9998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9998_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 30471941 - 30472164
Alignment:
| Q |
15 |
cataggacctaattaaaaggtgaccaaacgatataattgcgagagacaagatttggccatcactcaattgatcctaatatgtccaatttaattaccttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30471941 |
cataggacctaattaaaaggtgaccaaacgatataattgcgagagacaagatttggccatcactcaattgatcctaatatgtccaatttaattaccttca |
30472040 |
T |
 |
| Q |
115 |
tccatccttaaatataaaacctccatccatcgatttgtggtttttgtggacggg-tttcgttcgagtagcagaagataagtgtttggatctcgtttggag |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30472041 |
tccatccttaaatataaaaccaccatccatcgatttgtggtttttgtggacgggttttcgttcgagtagtggaagataagtgtttggatctcgtttggag |
30472140 |
T |
 |
| Q |
214 |
atttgcaatggtggttgaagattt |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30472141 |
atttgcaatggtggttgaagattt |
30472164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University