View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9998_low_30 (Length: 248)
Name: NF9998_low_30
Description: NF9998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9998_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 36814719 - 36814484
Alignment:
| Q |
1 |
gatgaggaccaattgacttactagtaaaagccactgttaatccatattatgnnnnnnnnnaagctgaaatctggaactgcattaacggcttgttgtacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36814719 |
gatgaggaccaattgacttactagtaaaagccactattaatccatattatgtttctttttaagctgaaatctggaacagcattaacggcttgttgtacag |
36814620 |
T |
 |
| Q |
101 |
ttgtgaaattacaacacccttttcgatcgacacaaaggtaggaagtggtattggtgtttggaggtggaattccaggtggaaaatcatcacaaatagaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814619 |
ttgtgaaattacaacacccttttcgatcaacacaaaggtaggaagtggtattggtgtttggaggtggaattccaggtggaaaatcatcacaaatagaacc |
36814520 |
T |
 |
| Q |
201 |
atcactcccactgtcagggtgttttttgtgtggtct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814519 |
atcactcccactgtcagggtgttttttgtgtggtct |
36814484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University