View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9998_low_33 (Length: 241)

Name: NF9998_low_33
Description: NF9998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9998_low_33
NF9998_low_33
[»] chr7 (1 HSPs)
chr7 (19-208)||(36814769-36814958)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 36814958 - 36814769
Alignment:
19 aagtatagctttgtccttgaaatgttatgtttggtttggttttgggaaccgtaactttctcactgaaaaatgacatgatgattgatgagccaagtaatta 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
36814958 aagtatagctttgtccttgaaatgttatgtttggtttggttttgggaaccgtaactttctcactgaaaaatgacatgatgattgatgagccaagtaaata 36814859  T
119 aatattcttaactacaacgaaacaaatcaaatcnnnnnnntgttgaactactaacaaattttttgtgtaccaggacaaaattagatacaa 208  Q
    ||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||    
36814858 aatattcttaactacaacgaaacaaatcaaataaaaaaaatgttgaactactaacaaattttttgtgtaccaggacaaaattagatacaa 36814769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University