View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: P12_high_11 (Length: 290)
Name: P12_high_11
Description: P12
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] P12_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 22362018 - 22361739
Alignment:
| Q |
1 |
acataccaagatactttcctttctgtcaaatagctgcaagaaatggacccttagagttctttggattcacaacctcatcaaaaaagagccatccacagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22362018 |
acataccaagatactttcctttctgtcaaatagctgcaagaaatggacccttagagttctttggattcacaacctcatcaaaaaagagctatccacagtt |
22361919 |
T |
 |
| Q |
101 |
tctagcaggtgctgcatcacttcttaagaccattttgggacctgaacttgcagctgcatttggtgtgagtgagggcactatgaaggacgtcgtcgatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22361918 |
tctagcaggtgctgcatcacttcttaagaccattttgggacctgaacttgcagctgcatttggtgtgagtgagggcactatgaaggacgtcgtcgatgct |
22361819 |
T |
 |
| Q |
201 |
caacgcgaagctgtaatacttccttcaacatgggctgctcc------tggaggtggagggaaaaaggaggaagatgttca |
274 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
22361818 |
caacgtgaagctgtaatacttccttcaacatgggctgctcctggtggtggtggtggagggaaaaaggatgaagatgttca |
22361739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University