View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: P12_low_11 (Length: 370)
Name: P12_low_11
Description: P12
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] P12_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 13 - 345
Target Start/End: Complemental strand, 33105694 - 33105362
Alignment:
| Q |
13 |
ataatactaaatagaaaagataaacaataaacaatggtcataaagaagagattgattttctagatttcattgactctgctcacgtttgctttcccctgtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105694 |
ataatactaaatagaaaagataaacaataaacaatggtcataaagaagagattgattttctagatttcattgactctgctcacgtttgctttcccctgtt |
33105595 |
T |
 |
| Q |
113 |
ttcctctgttgtgtctctcatatgctcaactagtagttcctttttctcagctcttgaaaattgtgtcagtgtgcatggcaagaatttgagccaaatcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105594 |
ttcctctgttgtgtctctcatatgctcaactagtagttcctttttctcagctcttgaaaattgtgtcagtgtgcatggcaagaatttgagccaaatcaat |
33105495 |
T |
 |
| Q |
213 |
aggtcaaatttaatgaagttcccatattttgggaaacttggaaggatcttcactgnnnnnnnaagaattctagctggtgatttttgttctctctatccag |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105494 |
aggtcaaatttaatgaagttcccatattttgggaaacttggaaggatcttcactgtttttttaagaattctagctggtgatttttgttctctctatccag |
33105395 |
T |
 |
| Q |
313 |
aaaaatcatcatccttgctaatagcaccatcca |
345 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
33105394 |
aaaaatcatcatccttgctaatagcacaatcca |
33105362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University