View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: P12_low_15 (Length: 237)

Name: P12_low_15
Description: P12
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] P12_low_15
P12_low_15
[»] chr4 (1 HSPs)
chr4 (35-214)||(9646753-9646930)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 35 - 214
Target Start/End: Original strand, 9646753 - 9646930
Alignment:
35 aatatgaacaaggcagatccacaagaggaaatagtagtcaacaagaaaactaataaag-ccctagaatggagtttgtccatagaagagattacaggaagg 133  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||    
9646753 aatatgaacaaggcagatccacaagaggaaatagtagtcaacaagaaaactaataaagtccctagaatggagtttgtccatagaagagattgcaggaagg 9646852  T
134 aataagggaagaacattgagaaccttatcatagttgaaaaagtagcaaataagatagattcacttactaagaaggacaagt 214  Q
    ||||||||||||||||||||||||||   |||||||||||||| ||| ||||||||||||||||| |||||||||||||||    
9646853 aataagggaagaacattgagaacctt---atagttgaaaaagttgcagataagatagattcacttgctaagaaggacaagt 9646930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University