View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: P12_low_16 (Length: 236)
Name: P12_low_16
Description: P12
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] P12_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 264680 - 264480
Alignment:
| Q |
17 |
attaagattatatataatcaaaacagtcaatttcacatggcaaaatcaagattaacataacctaactactaaaaatcataactaatgcaaggtataaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
264680 |
attaagattatatataatcaaaacagtcaatttcacatggcaaaatcaagattaacataacctaactactaa---------ctaatgcaagatataaaca |
264590 |
T |
 |
| Q |
117 |
aaataactataacaatttacgagatccaaaaccaaaaacataagagtgaattaaattaactacaagatcagatctagaaatagaaagcactactgactct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
264589 |
aaataactataacaatttacgagatccaaaaccaaaaacataagagtgaattaaattaactacaagatcagatctagaaatagaaagcactactgactct |
264490 |
T |
 |
| Q |
217 |
tgagttcatc |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
264489 |
tgagttcatc |
264480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University