View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-40 (Length: 174)
Name: R108-tnk148-40
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk148-40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 47465186 - 47465359
Alignment:
| Q |
1 |
agaacttgataacttatgcaatgatcaagaaatattgaagcttgagccaaagattatccttgctggttgtaggataaaccgttgattttttaaaatacta |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47465186 |
agaacttgataaattatgcaatgatcaagaaatattgaagcttgagccaaagattatccttgctggttgtaggataaaccgttgattttttaaaatgcta |
47465285 |
T |
|
| Q |
101 |
ctaaattccgtctgagtcaacaattattggcagggtagttgttgtataactaaattctgtttgtatcaattaat |
174 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47465286 |
ctaaattccgtttgagtcaacaattattggcagggtagttgttgtataactaaattctgtttgtatgaattaat |
47465359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University