View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-A8 (Length: 269)
Name: R108-tnk507-A8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk507-A8 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 36432172 - 36431906
Alignment:
Q |
1 |
tttatctgatgccggtgatgaccatgacggtgttcgttcggaggggcgttgaacaattagcataggtttggatgaggatgagggagatgaatttgaggac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36432172 |
tttatctgatgccggtgatgaccatgacggtgttcgttcggaggggcgttgaacaattagcataggtttggatgaggatgagggagatgaatttgaggac |
36432073 |
T |
|
Q |
101 |
gatgaagctgagagagaaacagggataagagcatcgttgagaaggttggaattgtcaccggaatcgggagattcttcgttttccggcaagacggcgagga |
200 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36432072 |
gatgaagccgagagagaaacagggataagagcatcgttgagaaggttggaattgtcaccggaatcgggagattcttcgttttccggcaagacggcgagga |
36431973 |
T |
|
Q |
201 |
ctccgaaggaatcgggagggcctaagggggaggatttgcgttggaattggtggtgattatagtgatg |
267 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
36431972 |
ctccgaaggaatcgggagggcctaagggggaggatttgcgttggaattggtggtgattgtagtgatg |
36431906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2484 times since January 2019
Visitors: 1237