View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R75-LTR4-TNT-insertion-14 (Length: 138)
Name: R75-LTR4-TNT-insertion-14
Description: R75-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R75-LTR4-TNT-insertion-14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 1e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 49134130 - 49134049
Alignment:
| Q |
1 |
cccaacacgtataaccattattcaggccatattactatccagtgtggaactctcgataggaacaaacgataaatagtgaatt |
82 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49134130 |
cccaacaagtataaccattattcaggccatattactatccagtgtggaactctcgataggaacaaacgataaatagtgaatt |
49134049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 49134044 - 49133991
Alignment:
| Q |
27 |
ccatattactatccagtgtggaactctcgataggaacaaacgataaatagtgaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| ||||||| ||||| |
|
|
| T |
49134044 |
ccatattactatccagtgtggaactctcaatgggaacaaaggataaatggtgaa |
49133991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University