View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R75-LTR4-TNT-insertion-19 (Length: 179)
Name: R75-LTR4-TNT-insertion-19
Description: R75-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R75-LTR4-TNT-insertion-19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 9e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 9e-78
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 18061306 - 18061136
Alignment:
| Q |
1 |
cccaacattcacctctctctatctttctccaacttgagtgaatcaagggccatgaaatgaagaaatacacatccagtagctcaaagatgtatggctgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18061306 |
cccaacattcacctctctctatcttttttcaacttgagtgaatcaagggccatgaaatgaagaaatacacatccagtagctcaaagatgtatggttgtgg |
18061207 |
T |
|
| Q |
101 |
tggtgactgcaccatgaaattattgtagtcagtcctcgtaccagataaaattaatagactaaattttgatc |
171 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18061206 |
tggtgactgcaccatgaaattaatgtagtcaatcctcgtaccagataaaattaatagactaaatttggatc |
18061136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University