View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R75-LTR4-TNT-insertion-4 (Length: 190)
Name: R75-LTR4-TNT-insertion-4
Description: R75-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R75-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 182
Target Start/End: Complemental strand, 11534158 - 11533988
Alignment:
| Q |
12 |
ggctgatttaacatggatcaataaaactctacaccccctccaagagagggtgtgatcgaagcaatgcaagagtgacaaattcaaaccaacggattgtaac |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11534158 |
ggctgattcaacatggatcaataaaactctacaccccctccaagagagggtgtgatcgaagcaatgcaagagtgacaaattcaaaccaacatattgtaac |
11534059 |
T |
 |
| Q |
112 |
ctcttccccatcatcactttgtaacactcaacggtaatgaatcatgttgtctataatcatcggacaattgg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11534058 |
ctcttccccatcatcactttgtaacactcaacagtaatgaatcatgttgtctataatcatcggacaattgg |
11533988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 12 - 112
Target Start/End: Complemental strand, 11533608 - 11533508
Alignment:
| Q |
12 |
ggctgatttaacatggatcaataaaactctacaccccctccaagagagggtgtgatcgaagcaatgcaagagtgacaaattcaaaccaacggattgtaac |
111 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11533608 |
ggctgattcaacatggatcaataacactctacaccccctccaagagagtgtgtgatcgaagcaatgcaagagtgacaaattcaaaccaacggattgtaac |
11533509 |
T |
 |
| Q |
112 |
c |
112 |
Q |
| |
|
| |
|
|
| T |
11533508 |
c |
11533508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University