View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R75-LTR4-TNT-insertion-9 (Length: 94)
Name: R75-LTR4-TNT-insertion-9
Description: R75-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R75-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 6e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 30545754 - 30545838
Alignment:
| Q |
1 |
cccaacagctatatggaccaacagtgcaacgttttagcgtaccttgtaggcatagttcatttgagattgtgtctgatttcaattg |
85 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30545754 |
cccaacacttatatggaccaacactgcaacgttttagcgtaccttgtaggcatagttcatttgagattgtgtctgatttcaattg |
30545838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University