View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SD37_7 (Length: 275)
Name: SD37_7
Description: SD37
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SD37_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 8342749 - 8343006
Alignment:
| Q |
7 |
taagttacatctgttcgagtttcagagaaaactttccctcttgaagtactcagatcaagttttctctgatgatttggctttactacaaagaggatatggg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342749 |
taagttacatctgttcgagtttcagagaaaactttccctcttgaagtactcagatcaagttttctctgatgatttggctttactacaaagaggatatggg |
8342848 |
T |
|
| Q |
107 |
agcaaaacgtataatatgtattttgcatttcatcaggttcaaaactctcttgtattttgacaactactatttatttccatatttttgtatattaatatca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342849 |
agcaaaacgtataatatgtattttgcatttcatcaggttcaaaactctcttgtattttgacaactactatttatttccatatttttgtatattaatatca |
8342948 |
T |
|
| Q |
207 |
ggacatggtacacaaggaaaagttcttgaaattgtgtcctgttcttttgtgtagaaca |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8342949 |
ggacatggtaaacaaggaaaagttcttgaaattgtgtcttgttcttttgtgtagaaca |
8343006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University