View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SD37_high_3 (Length: 431)
Name: SD37_high_3
Description: SD37
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SD37_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 19 - 413
Target Start/End: Complemental strand, 6917823 - 6917429
Alignment:
| Q |
19 |
acaccagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacagcatgcatgtgtgccaagaacagtcatcaaatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
6917823 |
acaccagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacatcatgcatatgtgccaagaacagtcatcaaatag |
6917724 |
T |
 |
| Q |
119 |
tgcaaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917723 |
tgcaaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagca |
6917624 |
T |
 |
| Q |
219 |
ttttatattgagtgtgctcaaacaacaagcaaaaggaaaatcagaacctatatgtttcggaatcaacctcgccgcgctcaatcttgatggcctggaactt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917623 |
ttttatattgagtgtgctcaaacaacaagcaaatggaaaatcagaacctatatgtttcgaaatcaacctcgccgcgctcaatcttgatggcctggaactt |
6917524 |
T |
 |
| Q |
319 |
gcctttctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgtttcctgttgcagaactg |
413 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6917523 |
gccattctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgttccctgttgcagaactg |
6917429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University